Ice Fishing at Strawberry

Steve refused to use a power auger to drill our holes. He's such a true outdoors-man. Look at that face!

Jack caught the biggest fish of the day, but we all had a great time.
Daniel and LauraDawn came to supervise. On our first date Steve told me, "You're a fun, fun girl. Can I call you again?" Right back at you honey. The fun times never cease with this guy.

Singing in the Rain

I wanted to watch 'Anne of Green Gables' the other night, but Jack asked for a kid movie. You know, like 'Singing in the Rain.'

Little News

When Jackson was a baby my friend (Katie Horrocks) lent us the cutest playmat. As I have been getting ready for baby #2, I keep thinking about how much I want a playmat. For some reason I want-need-must have the exact same mat. Too bad it sells for $60! That is some kind of conspiracy I'm sure. I found this barely used mat on KSL for $20. So here is another testimonial of KSL. Hooray! Jack is just as excited. He played with it all afternoon. Totally unaware that it wasn't for him. He asked for his pirate blanket and made funny little cooing noises.
Yes, this is my nightstand. I'm sick again...some kind of cruel world this is! Steve makes fun of my medications that only mask the illness and do nothing to cure it. My nightly routine has gone from a drink of water and chapstick to cough drops, blowing my nose, menthol rub, throat spray and then of course the drink of water and chapstick...oh and the hourly getting up to use the bathroom. Can Spring come already? I'm sure I'm getting sick from the kids at school. I use the antibacterial so much that I'm probably immune to it.

Pirate Curtains

The pirate room is underway (thanks to a fun fleece and pillow from Grandma Nonna) and now thanks to some new curtains. I followed nearly the same design as the previous curtains that were ingeniously and quickly made by Grandma Nonna.

Just a little background. My sewing projects are rather sporadic and so it is like learning all over again. I cut out the curtain panels and Steve started explaining, "Hailey they don't look square..." Of course they aren't square they are rectangle, right? Well apparently I cut the fabric on a slant. It goes back to my struggle with rulers. Sure I can make a straight line, but that doesn't translate to a straight and horizontal line.

To spare all the details, a project that ought to be accomplished in an hour or two took me a week or two, but they are now done and cute and ironed and hung and I feel a little more capable for the next sewing project.

Naming the Babe

We have been thinking of some names for baby boy number two.Of course the name Gilbert came to mind. Steve loves Anne of Green Gables.

Baxter really has been on my mind the whole pregnancy. It has been suggested as a cute dog name, though.


We are rather partial to Pirate Griffin. We're also hoping to use Derek as a middle name, but we don't know how to ask Derek. Any ideas?

All I wanted was Karoowia saxetia DNA sequences from Uruguay

I searched the world over (at least Uruguay) for this lichen, Karoowia saxeti, having never seen it. Well, I actually found it and the following is what I was after:

#NEXUS

BEGIN DATA;

DIMENSIONS NTAX=4 NCHAR=615;

FORMAT DATATYPE=DNA MISSING=? GAP=- ;

Karoowia_saxeti_540 CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACT--GAGAGAGGGGCTTCGTGCTCCCGGGGGTTTCGGCCCCTAACTCTTCACCCTTT-GTGTACCTACCTTTGTTGCTTTGGCGGGCCCGAGAACCCTCTCGCGCTGGCTCCTAGGTCGGCGAGCGTC

CGTCAGAGGCCCATTCAATCCTATTGATTAGTGACGTCCGAGTTCAAACAATAAGTAAAAA--CTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATT

GCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGCATTCCGAGGGGCATGCCTG

TTCGAGCGTCATTGCACCCCTCAAGCGTAGCTTGGTATTGGGCTCTCGCCCCTGCGGCGTGCCCGAAAAA

CAGTGGCGGTCCGGCGCGACTTTGAGCGTAGTAATATCCTCCCGCTCCAAAGCTTTCGTCGTGGCCGGCC

AGAGAACCCCACCGACTTCAATAATTGACCTCGGATCAGGCAGGGATACCCGCTGAACTTAAGCATATCAA

TAAG

Karoowia_saxeti_538 CTTGGTCASTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACT--GAGAGAGGGGCTTCGTGCTCCCGGGGGTTTCGGCCCCTAACTCTTCACCCTTT-GTGTACCTACCTTTGTTGCTTTGGCGGGCCCGAGAACCCTCTCGCGCTGGCTCCTAGGTCGGCGAGCGT

CCGTCAGAGGCCCATTCAATCCTATTGATTAGTGACGTCCGAGTTCAAACAATAAGTAAAAA--CTTTCAACAACGGATCTCTTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAAT

TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTCGGCATTCCGAGGGGCATGCCT

GTTCGAGCGTCATTGCACCCCTCAAGCGTAGCTTGGTATTGGGCTCTCGCCCCTGCGGCGTGCCCGAAA

AACAGTGGCGGTCCGGCGCGACTTTGAGCGTAGTAATATCCTCCCGCTCCAAAGCTTTCGTCGTGGCCG

GCCAGAGAACCCCACCGACTTCAATAATTGACCTCGGATCAGGCAGGGATACCCGCTGAACTTAAGCATA

TCAATAAG